/pics/biicon.ico"> /styles.css"> MARNA
/pics/alu-logo-130x130.jpg" width="130px" height="130px" border="0" alt="">
-->
">
"> /pics/bioinf-fr-logo-blau.jpg" width="130" height="130" border="0">
/pics/iif-logo-blau-.jpg" width="150" height="130" border="0" alt="">
/pics/alu-unilogo-schrift-200x66.gif" width="66px" height="200px" border="0" alt="">
/pics/alu-gray-bar-10x4.gif" width="10px" height="4px" border="0" alt="">
/pics/alu-red-bar-17x4.gif" width="17px" height="4px" border="0" alt="">
/?de"> /pics/lang-de.gif" width="21px" height="13px" border="0" alt="de"> /?en"> /pics/lang-en.gif" width="21px" height="13px" border="0" alt="en">

->

A Server for Multiple Alignment of RNAs

Please note: MARNA is not supported anymore. For the task of multiple RNA alignment, the more advanced tool LocARNA is superseding MARNA. The LocARNA web server as well as the stand-alone program is available at http://rna.informatik.uni-freiburg.de.

MARNA is a multiple alignment of RNAs taking into consideration both the primary sequence and the secondary structure. It is based on pairwise comparisons using costs of edit operations. The edit operations can be divided into edit operations on arcs and edit operations on bases. Additionally, MARNA predicts a consensus sequence as well as a consensus structure.

MARNA is now downloadable ! Click here.

Scores : MARNA allows you to tune your individual scoring set. For simplicity, you can attach importance to sequential parameters, to structural parameters, to a mixture of both (default) or to its individual parameter set.

sequential
sequential/structural (default)
structural
You may specify your own costs (see article for explanation). Note, that costs are minimized :

arc removing
arc breaking
arc mismatch
base deletion
base mismatch

Input : You can paste your RNAs in a FASTA like format. It consists of i) sequence names, ii) primary sequences and probably iii) secondary structures(given in parenthesis notation). For example, one RNA looks as follows :

>AB013372
GCGCCCGUAGCUCAAUUGGAUAGAGCGUUUGACUACGGAUCAAAAGGUUAGGGGUUCGACUCCUCUCGGGCGCG
(((((((..((((.........)))).((((((....).))))).....(((((.....)))))..))))))).
		  

If you don't specify any structure to a sequence, then you can choose whether this sequence should adopt the minimum free energy structure, an ensemble of shaped structures (using RNAshapes) or an ensemble of highly probable structures (using RNAsubopt, current number of structures is 3) :

minimum free energy structure (default) shaped structures structure ensemble

An example of 5 tRNA sequences with given structures is given here. You can paste them into the text area below. The max. sequence length should not exceed 500 nt. The number of sequences depends on sequence lengths. The total sum of all sequence lengths is restricted to 10000 nt, e.g., you can paste 20 sequences with lengths of 500 nt each, or 100 sequences with lengths of 100 nt, each.

Example

Please enter your email address :


Please cite:
Sven Siebert and Rolf Backofen, "MARNA: multiple alignment and consensus structure prediction of RNAs based on sequence structure comparisons", Bioinformatics 2005, Volume 21, Issue 16, 3352-3359

If something seems to be wrong, then don't hesitate to write an email to : rna[ @ ]informatik.uni-freiburg.de